| SGN ID: SGN-C1039 | Clone name: cLEC-10-J15 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E201277 | Length: 415 bp (629 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E201277 [] (trimmed)
ACGGTCCAATTTGCTTCAAGGTTCACTACCTATTCCACCGAATTCTACCAGATACTTCTTAATATCCCAAAATAATCTCACCGAAGAAATTCCTC
CATCTATTTGCAATTTGACATCACTGATAATGCTAGATTTGGCTAGAAATAACTTGAAGGGAGCAATTCCGCAATGTTTGGGTAATATTAGTGGC
CTCGAGGTTTTGGATCTTCACAACAACAAACTTTCTGGGAATATTCCAACAATTTTCAGCAATGGAAGTTCACTGAGAAGCCTCAACTTGCACGG
AAATAAACTTGAGGGGAAAATTCCCCGATCTTTGGCTCATTGCAAAGACTTGCAGGTTCTTGATTTAGGAGATAATCATCTCATTGACACATTTC
GCCCCCTTTAAATTTGGGTTTGGGGGGGGGTTTTT
[BLAST] [AA Translate]
| SGN-ID: SGN-T24864 [Download] [View] |
Facility Assigned ID: TCABM56TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.964 |
Expected Error Rate: 0.0015 |
Quality Trim Threshold: 14.5 |
