EST details — SGN-E201454

Search information 
Request: 201454Match: SGN-E201454
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C8151Clone name: cLEC-4-I19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167788 [TUS-1-G18] Trace: SGN-T465 EST: SGN-E379193 Direction: 3' Facility: Avesthagen
Clone: SGN-C167788 [TUS-1-G18] Trace: SGN-T1243 EST: SGN-E379759 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201454Length: 454 bp (821 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201454 [] (trimmed) AATTGATTGAACAGCTTCCCAAGACAATTTGCAAAAGCATAAGGCACCATTTGTTTTTACCAACAGTGGAGAAAGTTTATCTTTTTAAAGGTGTC
ACAAAGGAAATTCTGTTACTTTTGGTTGCAGATATGAAGGCTGAGTACATACCTCCAAGAGAGGATGTAATAATGCAGAACGAATCACCAGACGA
GTTGTACATCATAGTGTCAGGGGAGGTGGAAATGATTGAATCTGAAATGGAGAATGAGCCAACTGTTTGGACTTTCAAATCTGGAGATATGATAG
GAGAAGTAGGGGCATTGTGTTGTAGACCTCAGAGCTACACGTATCGAACCAAAACACTTTCACAGCTCTTGAAGATAAGAACTAGTAATTTGATT
GAAGCAATGAAAACCAGACAAGAAGATAATATCATCATGATCAAGAACTTCCTTCAGCATCATAAGAAGCTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201454] SGN-U568026 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24404 [Download] [View] Facility Assigned ID: TCAAM58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0171 Quality Trim Threshold: 14.5