Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E201984

Search information 
Request: 201984Match: SGN-E201984
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14318Clone name: cLEC-7-I22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172937 is on microarray TOM1: SGN-S1-1-2.2.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172937 [TUS-14-N7] Trace: SGN-T196606 EST: SGN-E395280 Direction: 3' Facility: INRA
Clone: SGN-C172937 [TUS-14-N7] Trace: SGN-T196607 EST: SGN-E395281 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201984Length: 456 bp (735 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201984 [] (trimmed) CTAAAAGCTGTGACACATATAGATCTGTCGATGAATCAATTCTCAAAAGGAATTCCTAGGGAAATTGGAGCATTGCAAAATTTGGAGTACCTTTC
TTTGAGGCACAACAAGTTGCAAGGATCTATACCTGACTCATTCAGCAACATGGTAAGTTTGGGATACCTAGACATTTCACATAATAATGTATCGG
GAACTATACCCATGTCTTTGGAGAAACTACAATACCTCAAGTATTTCAATGTTTCTGTCAACAAGCTGTACGGTGAAATACCCTCGGGGGGTCCT
TTCAAGAACCTCTCGAGTCAATTTTTCATCGACAATGAAGCATTGTGTGGTTCTTCAAGGTTTAGTGTTCCACCGTGCCCCACATCATCAAAGCA
TAGATCAAATAGGAAAAAAATGCTTGTTCTATTTCTTGTGCTGGGAATCGCACTTGTACTGGNTCCTATTATCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201984] SGN-U582489 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25266 [Download] [View] Facility Assigned ID: TCAAZ59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5