EST details — SGN-E202090

Search information 
Request: 202090Match: SGN-E202090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14223Clone name: cLEC-7-E1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172887 is on microarray TOM1: SGN-S1-1-4.4.20.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202090Length: 484 bp (750 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202090 [] (trimmed) TAAAGCTTCTTTGGCCGACATAACATGATTTTATAGAGCGTAGATCGCTATCATACAAACTACATATAATACATTGGGAAACAAGAAAAAAAAGA
TCTTTTTTTTTTCTTGATTTTTAATCAATCTAGGAGACCTAACTGGTTCATTTTCTGAGCCAGAGAAGGTGAATTCTGAGGTGTGGGAAAGCATG
TCTTACCAAAGGGCTGAGAGATTGGGTTACATGAATCTTGATGAAGAGATGGCAGATACGATGGATGAATTTGAAGAGGTATTCTACAATGAGGA
CCCAAACCTTGATGACTTTGAGATGGTAACAGAAGGGACAGATACATCCGCTGCACAAGCAAGGAAAGGCAAAGACATACAAGGTATCCCGTGGG
AGAGATTGAATATAACAAGGCAAAGTTACAGATTGACAAGGCTCGAACAATACAGGAATTATGAGAACATACCTTTGTCTGGAGATGCTGTAGAT
AAGGAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202090] SGN-U585692 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25372 [Download] [View] Facility Assigned ID: TCAAY25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5