EST details — SGN-E202125

Search information 
Request: 202125Match: SGN-E202125
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14442Clone name: cLEC-7-O9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172994 is on microarray TOM1: SGN-S1-1-1.4.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172994 [TUS-14-P16] Trace: SGN-T188129 EST: SGN-E374821 Direction: 3' Facility: INRA
Clone: SGN-C172994 [TUS-14-P16] Trace: SGN-T188130 EST: SGN-E374822 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202125Length: 544 bp (705 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202125 [] (trimmed) GAGAAGCTGAATTGAACTCTTCCCATTGTTCTCCGTTCATCCCCGCCGGAGCAATTTTTCCCATGGCGAAAACCTTAATTTCATCTCCATCATCG
TTCATCGGAACTCCTTTGCCGTCGCTTTCTCGCCATGTATTTCACCGGCGAAGACTTATCTCTACTAGAGTGAAATTCAGCTTCCATGACCTTCC
TCCGATTCACTCGCTTCACTCTAATTTTGATTTTGAAGCTGTTGTAAGCCGAGCGGAGGGACTTCTCTACACGTTAGCTGATGCTGCCGTCGCGG
CTGATCCTGGTGTTGCTCCCGATGTTACTGCTGCCGGTACTGCTCAGAAAAGTGGTGGTTGGATTGCTTTCATTTCTGACGCCATGGAAGTTGTG
TTGAAGGTGATGAAGGATGGACTGCAAGCTGTGCATGTGCCTTATTCCTATGGATTCGCAATCATATTGCTTACTCTCCTGGTTAAAGCTGACAC
TTTCCCTTTGACAAAGCAACAGGTTGAATCAACTTTAGCAATGCAAAATCTCCAACCAAAGATCAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202125] SGN-U581345 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25407 [Download] [View] Facility Assigned ID: TCAAY89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5