EST details — SGN-E202158

Search information 
Request: 202158Match: SGN-E202158
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14431Clone name: cLEC-7-O18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172988 is on microarray TOM1: SGN-S1-1-7.4.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172988 [TUS-14-P10] Trace: SGN-T188051 EST: SGN-E374743 Direction: 3' Facility: INRA
Clone: SGN-C172988 [TUS-14-P10] Trace: SGN-T188052 EST: SGN-E374744 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202158Length: 393 bp (744 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202158 [] (trimmed) TAAACATCCTAATCTGTCGGTTAAAAATTCATCTGCGTAATTTGAAAGACGAATTTTTTTTAAAAAAAATCAATGGCGACGGCTATGGGAATGAT
GAGGAATGTTGGGGGTTATGGTTCTGCCTCTGCTTCATGGATTCGTTTGAAGAATCGCGCAAACAAAAAGACGAAGAGGAGTGAGAATGTTAAAT
TTGGGGTTACTTGTGTTTATTCACCTTCTCTGAGTGATCCGTACAAGACCTTGAGGATTCAACCTGATGCTTCTGAATCTGATGTTAGAAAGGCT
TTTAGACAGCTTGCTCTTCAGTATCACCCGGATGTATGCAGAGGAAGTAATTGCGGTATACAATTTCACCAAATCAATGATGCATACGATACTGT
GATGAGTAACTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202158] SGN-U580038 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25440 [Download] [View] Facility Assigned ID: TCAAZ93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5