EST details — SGN-E202173

Search information 
Request: 202173Match: SGN-E202173
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14289Clone name: cLEC-7-H11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172920 is on microarray TOM1: SGN-S1-1-3.1.20.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172920 [TUS-14-M14] Trace: SGN-T1264 EST: SGN-E378491 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202173Length: 461 bp (799 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202173 [] (trimmed) CAAAACTCCACAACATCACGACAACAATGAGTTTTGATGATGATGATGATCATCCATTTTTTCATAGAAAAAACAAATATGATCTTAATAGCAAG
ATCATGATAACAGCCATAATTTCATTATCTATAGTTATTTTCTTCGTTACTCTCCTCCATATTTACGCGAGGTGCGTCCTCAGACGCCAGGCTAG
ACGTAGGGCGGAGCTTCAGCGCGTCAGCTTCATCACCAGCTCCGCCCTACATGTCGAGCCCCCTAAGACGGGGCTTGACCCGTCCGTGATAGACT
CGCTACCGGTATTTATTCTCAAACAGAATGATATTAATCAAAATAATACAATTGAGTGCACGGTTTGTTTGAGTGCTCTTGAAGATGGAGAAAGG
GTTAGAAATTTGCCTAATTGCAAACATGTGTTTCATGCTGAGTGTATTGACAAGTGGTTTGGGTCACACTCAACGTGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202173] SGN-U584996 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25455 [Download] [View] Facility Assigned ID: TCABA42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5