EST details — SGN-E202212

Search information 
Request: 202212Match: SGN-E202212
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14298Clone name: cLEC-7-H20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172927 is on microarray TOM1: SGN-S1-1-4.1.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T195325 EST: SGN-E393999 Direction: 5' Facility: INRA
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T195604 EST: SGN-E394278 Direction: 5' Facility: INRA
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T195604 EST: SGN-E398986 Direction: 5' Facility: INRA
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T195762 EST: SGN-E394436 Direction: 3' Facility: INRA
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T195762 EST: SGN-E398985 Direction: 3' Facility: INRA
Clone: SGN-C172927 [TUS-14-M21] Trace: SGN-T199440 EST: SGN-E398114 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202212Length: 455 bp (979 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202212 [] (trimmed) GCAGAAGCAATTCATTTGTTATCTGAAGGTCAAGCAGAGGGGATAACTCAAAATACTTAAAGGTAGAAGCTATCAGCTAAGAACTACACATGGAC
AAGGGGGCTATTCTTGAAGCTGGAGAGGGAAGAAATACCGTTGAACTTGTGAAATCAGCCTCTGAAAAACATCTTGACCTTTTGAGGCCATCAGC
TCGATATTATTCAGTGTCGAAAGGGCAAGCTGGTGATGCAGAAGACCGTGAGAAGGGAAAGTATACCTTGATTAGAGATGTAGAGGACCTTCAAA
CAGGGTTCTATGATAAACCTCTTCCTTGCTTTGGTTGCGGAATCGGATGGTTTTCATTTCTTCTGGGATTTCTATGCCCGTTGATGTGGTATTAT
GCCACGATACTTTATTTCGGAAACTACTACCGTAAGGATCCTAGAGAACGTGCTGGGCTTGCTGCATCTGCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202212] SGN-U574701 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25494 [Download] [View] Facility Assigned ID: TCABB46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5