EST details — SGN-E202290

Search information 
Request: 202290Match: SGN-E202290
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10739Clone name: cLEC-6-C16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172643 is on microarray TOM1: SGN-S1-1-8.2.20.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202290Length: 602 bp (865 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202290 [] (trimmed) GAGAGGTGCAAGGTTTTCTAGTTCAATGTTTGGAGATGATATCTTCAGTTCATTTGGAGAAGGCAGACCAACCATACGGAAGGCGCCACCGATTG
AACGAACAGTCCCTTGTAGTCTAGAAGAACTTTATAGTGGGACAACCAAGAAGATGAAGATCTCTAGGGAGATTGCTGATGCAAGTGGGAAGACT
TTACCAGTAGAAGAAATTCTGACCATTATAATCAAACCTGGCTGGAAGAAGGGAACGAAGATTACATTCACAGAGAAAGGAAATGAAGAGCCAAA
CGTTCTTCCTGCAGATCTCGTGTTCACAATTGATCAGAAACCGCACAGTGTTTTCACAAGGGATGGGAATGACCTTGTAATCAATCAGAATATCT
CACTTGTTGAAGCATTAACAGGTTACACAGCCCATGTAACAACGCTTGATGGAAGAAAACTGACTATTCCTATCAACAAGGTAATACACCCAAAC
TATGAAGAGATTGTCCCAAAGGAAGGTATGCCACTACCCAAAGATCCTTCTAAGAGAGGAAATCTGAGGATCAAGTTCAATATCAAGTTCCCTAC
AAGGTTAACAGCAGATCAGAAGACTGGAATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202290] SGN-U573688 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23951 [Download] [View] Facility Assigned ID: TCAAV20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5