EST details — SGN-E202353

Search information 
Request: 202353Match: SGN-E202353
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10992Clone name: cLEC-6-N19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172815 is on microarray TOM1: SGN-S1-1-4.1.20.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172815 [TUS-14-I5] Trace: SGN-T195311 EST: SGN-E393985 Direction: 5' Facility: INRA
Clone: SGN-C172815 [TUS-14-I5] Trace: SGN-T195581 EST: SGN-E399523 Direction: 5' Facility: INRA
Clone: SGN-C172815 [TUS-14-I5] Trace: SGN-T195749 EST: SGN-E394423 Direction: 3' Facility: INRA
Clone: SGN-C172815 [TUS-14-I5] Trace: SGN-T195749 EST: SGN-E398945 Direction: 3' Facility: INRA
Clone: SGN-C172815 [TUS-14-I5] Trace: SGN-T199436 EST: SGN-E398110 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202353Length: 535 bp (712 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202353 [] (trimmed) AAAATCTTTTTTTCTCTGCTGTAAGGCGGAAGAAAGAGAAGGACTGTTATTTGAAGAACGGAAGTTGTGTGCTTCAGGAGCTTCTTGCTTTATGC
GACGGAAATTGCAGAGTTCCCATCCGTTACTTCTCTGCCATAGAGATCAATAATGCAATAAAAAACTCTCAAACCAAAATGGAACTTGCTGATGT
GTCTATGGTTACGGGATTACTAGGCAACCGCCCTGTATTAGTTAGGTTCAATAAATGGACCTACAATATCCATCGAGATATAGCGATTACTGCTC
AGATGAGTCATCTGAAGAATGTGCTGAGACTAATCGGTTGCTGTCTAGAGTTTGAAGAGCCAGTTATCGTGTATGAATATGTTAAAGGTATATCT
CTTAGCGATCTACTTTTCAAAAAGGGTAATCTTAATAGAAAATCGTCCTTGTCTTGGGGAAGTAGATTACGAGTTGCACGTGATGTCGCTTCTGC
AGTCGTTTTCCTCCATACTGAATTTACTACGCCAATCATCCACAGAAATATAAAGTCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202353] SGN-U563913 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24014 [Download] [View] Facility Assigned ID: TCAAW82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5