EST details — SGN-E202382

Search information 
Request: 202382Match: SGN-E202382
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10907Clone name: cLEC-6-J4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183903 is on microarray TOM1: SGN-S1-1-4.3.19.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183903 [TUS-43-G5] Trace: SGN-T196233 EST: SGN-E394907 Direction: 3' Facility: INRA
Clone: SGN-C183903 [TUS-43-G5] Trace: SGN-T196234 EST: SGN-E394908 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202382Length: 388 bp (785 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202382 [] (trimmed) GAGAATGTCTCTGTCTGTACTATGATAAGCTCTACGAGTTGCATTCACAGTATCCGTCCAAACGTCATGCTCTTTCAAAATATTGTTAAACAAAT
GTGTCTGCAAGTAGTTTGCTACATCATGGCCCATATGTCCATCATAGATTGCGAATAGTCCCAAATCGTTGTTATGGACTTGCTTAAACTCACAA
ACTAAACAATCTTCCATCGCGTGATTAGACTTTCCCTTCACCAGGTGGGAACCATGAGTGATCCGCTTTGATGCTCCGCCCTTGCCTCTTGTATC
TGGTGAGTCTGGCATGGAAGCCATAAAACATGCCTTTTCCTTCATCTTGTGCAGGATTTCTCTTCCTCCAGTCATGATTTTGAAATAGTTTTACA
AAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202382] SGN-U567601 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24043 [Download] [View] Facility Assigned ID: TCAAX50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5