EST details — SGN-E202383

Search information 
Request: 202383Match: SGN-E202383
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10909Clone name: cLEC-6-J6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172763 is on microarray TOM1: SGN-S1-1-8.3.20.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172763 [TUS-14-G1] Trace: SGN-T195303 EST: SGN-E393977 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202383Length: 473 bp (763 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202383 [] (trimmed) AGAAGAAGCAAAGAATGGAGAGTTCAGCAGTAGCATCCGATCTGGTGGATTTCTTGAACGCTTCTCCTACAGCTTTTCACGCAGTTGATGAAGCA
AAGAAGAGACTTAAAAGTGCAGGGTATGTACAGATAGATGAGAAACTAGATTGGGATTTGAAAGCTGGGAACAAGTATTTCTTCACTAGGAACTA
CTCTACTATTGTTGCTTTTGCTATCGGTAAAAAATATGTTGCTGGAAATGGATTTCACATAGTTGGTGCTCATACAGATAGTCCTTGTCTGAAGT
TGAAGCCGGTTACGAAGGTAATTAAAAGTGGATTTTTGGAAGTGGGTGTACAAACATATGGTGGAAGGCTGTGGCATACTTGGTTTGATCGAGAT
CTAACAGTTGCCGGAAGGATGATCATAGGAAATGAGAATGATAGTTCTGAATCCTACTTGCACATGCTTGTGAGAATTGACGAGCCTATAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202383] SGN-U581821 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24044 [Download] [View] Facility Assigned ID: TCAAX51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5