EST details — SGN-E202415

Search information 
Request: 202415Match: SGN-E202415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10779Clone name: cLEC-6-E11
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172670 is on microarray TOM1: SGN-S1-1-5.3.20.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195209 EST: SGN-E393883 Direction: 3' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195651 EST: SGN-E394325 Direction: 3' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195651 EST: SGN-E399536 Direction: 3' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T195652 EST: SGN-E394326 Direction: 5' Facility: INRA
Clone: SGN-C172670 [TUS-14-C4] Trace: SGN-T200205 EST: SGN-E399024 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202415Length: 572 bp (658 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202415 [] (trimmed) GTAATTAGGGAATGAAAATCCTACATATGACAAGTAAGAAGAATCATTGGAAGGAATGAACAATATATGTCACATCCTAATTCTATTCTGTGATA
AGGTTCCCTGGTTCATAAACTCTAAGCTGACTGGTCATATCTCTCTACCAAGAGAAAATAGGGAAAATACCATACTCTTAAGATTCTATAAACCC
TTGATTGGTACATATACTTTTTAAGTTTGTAACTCTACCTGCTTTCTTAACCTAGTGATGGAGTTACCTAATGTGTTGAACCCCTGAAGGATCAA
GGACCATAAATAGTTGGAACAAGTCATCATTGCCTTTTAAAAGCAAATATTTCAACTATTTATTTATTAGGACAAAATCAATTGAAAAAAAGAAA
CTTAAGAGTTCCATTATTTATGGTCAAATAGAAAAAGATAAAACCAAAATAACGGAGTTGCAATTGTGTACTCCTTGTTGTTATATCTTTAAGAT
GCAATGACTTTTTTTATGCCAACTCTGTTTTTAAAAATTACTTGGTTAGAGCTCCTTTATATGTATTCCTCTTCTTCGATTAACATGGAAGTAAC
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202415] SGN-U575636 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24076 [Download] [View] Facility Assigned ID: TCAAU30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5