EST details — SGN-E202477

Search information 
Request: 202477Match: SGN-E202477
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10934Clone name: cLEC-6-K8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172779 is on microarray TOM1: SGN-S1-1-8.3.20.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195120 EST: SGN-E393794 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195308 EST: SGN-E393982 Direction: 5' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195576 EST: SGN-E394250 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195576 EST: SGN-E398937 Direction: 3' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195577 EST: SGN-E394251 Direction: 5' Facility: INRA
Clone: SGN-C172779 [TUS-14-G17] Trace: SGN-T195577 EST: SGN-E398938 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202477Length: 605 bp (827 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202477 [] (trimmed) CTTTCTATCATTCAATTTTTAGAATTGTTTTATCGAATAATATTCAGTTATGGTAACGTTGTTTCTCCCCATACACCTCTTGTGAGATGTTTTTG
TAGTAGTTATGCGTTTCTCAACTATTCTTGCCTTTCTTTGCCCCAGGATTATTTTTGAATTAATACAAGAACAAGAAGGCTTATACATATTTGCT
GATAGAGAAGTGAGAACTAAAACAATGGCACGTCCTTTCAACATCTTTGCTCTCAAGCTACAAATACACTGCAAGTATTGTGCAAGGGAACTGAA
AAAAGAGCTGCTAAATATCAAGGGAGTTCGTTCGGTGAAAATCAATCAAGAACTTGGAAAAGTAATCATCTCAGGCAAAGTAGATCCTGAAAAGA
TCCTATTCAAGCTCCAAAAGGTTGGGAGAGAAGCAGAACTCTGGTGTGAACAAGAACGACCTCCTAAAGATGTTAACGTGCTACCTAAAGTGACT
GATCCACTGAATGATCCTGACATTATGACACAACTAGAGAAATTTTCTGATGACCCCAGTGTTATAAGTGTGGAGGTGACCAAAACTATCAAGGT
GATTTTCAAAGGGGAATCAAGAAATGTGCCTACTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202477] SGN-U570454 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24138 [Download] [View] Facility Assigned ID: TCAAV64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5