EST details — SGN-E202619

Search information 
Request: 202619Match: SGN-E202619
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3099Clone name: cLEC-19-H2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183605 is on microarray TOM1: SGN-S1-1-6.2.1.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183605 [TUS-42-J19] Trace: SGN-T196095 EST: SGN-E394769 Direction: 5' Facility: INRA
Clone: SGN-C183605 [TUS-42-J19] Trace: SGN-T200372 EST: SGN-E399399 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202619Length: 552 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202619 [] (trimmed) CAGAGAAGACCCATGCACTCAATATTGGGTCTGCTCTCCTTGTTGCAAGATGAGAAATTGGGTAATGAGCAGCGGCTTCTTGTGGATTCAATGGT
TAAAACCAGTAATGTCGTGTCAACCCTAATAGATGATGTGATGGATACTTCAACAAAGGACAACGGTGGATTCCCTTTGGAGATGAGATATTTTC
AGCTACATTCCATGATAAAAGAAGCTGCTTGTCTTGCCAAGTGTTCGTGTGCTTATAGGGGTTATAATATTTCCATTGAGGTTGACAAATCTTTG
CCAAATCATGTTCTCGGTGATGAAAGAAGAGTCTTTCAAGTTATTCTTCATATGGTTGGAAATCTTTTGAAGGACCCCAATGGAGGTCTTCTCAC
ATTTAGGGTTCTCCCAGAAAGTGTAAGTAGGGAAGGCATTGGTGGAGCATGGAGAACAAGGAGGTCAAACTCATCTCGTGATAACGCCTATATCA
GGTTTGAAGTTGGAACAAGCACTAATCATTCTCAGCCAGAGGGGACCATGTTGCCACATTACAGGCCAAAACGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202619] SGN-U581695 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27460 [Download] [View] Facility Assigned ID: TCACX37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5