EST details — SGN-E202812

Search information 
Request: 202812Match: SGN-E202812
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C284Clone name: cLEB-1-O13
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202812Length: 161 bp (262 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E202812 [] (trimmed) GCTCCTCTCTCCTTATCCATGGCGTCTACATTCCTTACATTGGCTAAACCCTTCACTTCTCACTCAACAAATCTTCCTTCTTTCTCTCCTCAAAG
ACCCATTGGTCTGAGAAGAAATTCTTTGAGAATTAATGCCATTTCCCAGAAATGGGAACCCACAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202812] SGN-U580696 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23445 [Download] [View] Facility Assigned ID: TSHAA91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0000 Quality Trim Threshold: 14.5