EST details — SGN-E203081

Search information 
Request: 203081Match: SGN-E203081
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C404Clone name: cLEB-3-F15
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C404 [cLEB-3-F15] Trace: SGN-T22828 EST: SGN-E203082 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203081Length: 368 bp (918 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203081 [] (trimmed) CTCCCTCATTTTCCTCTCTTTAAAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCTCCTTCTTTTGCCGGACAGGCAGTGAAACTCTCACCCT
CTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATGAGAAAGGCTGTTGCCAAGTCTGCCCCATCTAGCAGTCCATGGTATGGCCCTGACCGT
GTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGACTGGTGAATTCCCTGGTGACTACGGCTGGGATACCGCTGGACTCTCAGC
AGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCATATGGGCTATGCTTGGTGCTCTTGGATGTGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203081] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22827 [Download] [View] Facility Assigned ID: TSHAK32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5