EST details — SGN-E203090

Search information 
Request: 203090Match: SGN-E203090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C437Clone name: cLEB-3-H15
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C437 [cLEB-3-H15] Trace: SGN-T22837 EST: SGN-E203091 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203090Length: 365 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203090 [] (trimmed) CCGGCAACCAACTTTGTTCTGAGAAAATACTTCATTGCTAGCTGTAGCTCGACGGACGGCGGTAAGCAGAACGGCCGGAGGTGATTCCATTTGCT
GTAGAAAATCACAAAATCCAAGCAAGATTAGAAAGAGCATCAGCCTCAAACAAGGAAGTACTATATCTACTACTAATCTTGGTCCTTCATTCACT
TGAGATGTCTTTGTGTAGACCTCCACTTCCTCGACTTCTGCTGAATAACGTCTCGTGTATGAGAAATGCTCAACAAATTTTGCGCCACATAAATG
TTTCCCTCCATGATGGTGGTGCACTGGTACTAACAGGCACCAATGGCTCTGGTTAATCCACATTCTTGCGCATGTTGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203090] SGN-U574109 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22836 [Download] [View] Facility Assigned ID: TSHAK44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5