EST details — SGN-E203091

Search information 
Request: 203091Match: SGN-E203091
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C437Clone name: cLEB-3-H15
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C437 [cLEB-3-H15] Trace: SGN-T22836 EST: SGN-E203090 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203091Length: 474 bp (732 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203091 [] (trimmed) GCTGACAAAACAAAGCTAAGACTTATCTTATATTGTAATGTCCAAAGTTGTTACAAAAGCCAAATAAGTACTGAATTCTGTGGTTCAAACTAGCA
TACAAACAATAAAGCTATTTGGGATGTTGTATAAGAGAAACGCAACATCTGATAATCTGATGCAAGGTGTTATCTACAAAAATTCTTTTACAAAA
AAACTAGAAATCCCCGAGTGCCGGCCGACAGGGTTCGAAACTCGATGGATAATGAACTTACCCCTCCTTGCTGCTTAAATTACAAGCTTTTGTCT
GCAACGAATTCAAACTCGTGACATTCGTCTAATCCACACATCCAATGTTGCCGTTCATACCATTAGACCAATGAGGGCATGTGTTCTCAGCACAT
TTTAGGGGCAAAGTGAAGTGCAAATTGAGGAGGAGCTAACAAAGTAAAGATAGAGAAATTCTTGCAATCATCAAGAATGAAAGAGAAAACAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203091] SGN-U574109 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22837 [Download] [View] Facility Assigned ID: TSHAK44TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5