EST details — SGN-E203126

Search information 
Request: 203126Match: SGN-E203126
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C568Clone name: cLEB-3-P15
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C568 [cLEB-3-P15] Trace: SGN-T22871 EST: SGN-E203125 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203126Length: 430 bp (727 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203126 [] (trimmed) CTCCTCTGCCTTCAACTGTTGAAGCTGTCCCAACAATAGCTCCGCCGCCTCCGAAATTGTCTTCCCTTGAACTTGATCAACCAAATCAACATCAC
AACCGAACCCTAATCCCATCCCATTCAAATTCGACAAATTCTTCGTCAAACCCTTAAGTAATTTCATCTTCTTCTTCGTTTTCTTCAACTCCGCC
ATATCCTTCTCTTTGTTCTTCTTCTTCCCACACCTAATAATTCCACCTCTACCAGATGAATAATACTCCAAACAACCCTCATCGTAAAACCCACA
ACCCATTGATTTCAAACTAACACGTGAAACACTACAACTACGATTCAACGGATTGCTGCTAACTCCGACACCGGCGCCGGTGACTGAAGGAAATC
GGCGTAAAACTCCGGCAGAGGCTTCCATTATGGATGATCAAATCCTCGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203126] SGN-U579250 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22872 [Download] [View] Facility Assigned ID: TSHAK92TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0092 Quality Trim Threshold: 12.5