EST details — SGN-E203214

Search information 
Request: 203214Match: SGN-E203214
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C539Clone name: cLEB-3-N20
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C539 [cLEB-3-N20] Trace: SGN-T22961 EST: SGN-E203215 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203214Length: 304 bp (693 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203214 [] (trimmed) CAACGATAAGTTGGCTTCTACCACTATATAAAACCGGTTCTTTCTTGAAATCAACTTGATTAGGTTTGGAATCATATCTTTGCATTTACGGTGAT
GGACTGGGACGAAGGAAGCGAAATAAAGAAGAGGATCGTCATTGGATCATGGGGTGGTCATGGTGGAAGCCCTTGGGATGATGGTAGCTTCAATG
GAGTTAGAGAAATTACCCTTGTCTATTCTCTTTGTATAGACTCCATCACTGTTGTCTATGACCAAAATGGCCAGCCTTATCAAGCAGAGAAGCAT
GGAGGAGTTGGAGGCAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203214] SGN-U577384 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22960 [Download] [View] Facility Assigned ID: TSHAL82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0203 Quality Trim Threshold: 14.5