EST details — SGN-E203293

Search information 
Request: 203293Match: SGN-E203293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C376Clone name: cLEB-3-D21
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C376 [cLEB-3-D21] Trace: SGN-T23038 EST: SGN-E203292 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203293Length: 532 bp (731 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203293 [] (trimmed) CTATTGTTCAAGTAAACTCACAAATTACAACTTTACATGGTCAACAAATGATCAGAAACTTGAGAATGTTTTAAGATTTTTATTTTCCGGGGACA
AAGTTTGTGGCGTAAGACCAGGCGTTGTTGTTTACTGGGTCTGCAAGGTGATCAGCAAGGTTCTCCAATGGTCCCTTTCCAGTAACAATGGCTTG
AACAAAGAATCCAAACATAGAGAACATAGCAAGTCTACCGTTCTTAATCTCCTTTACCTTGAGCTCAGCAAATGCCTCAGGGTCTTCAGCAAGGC
CTAATGGGTCGAAGCTGCCACCTGGGTAGAGTGGGTCTACAACCTCACCAAGAGGTCCACCAGCAATACGGTAACCTTCAACGGCTCCCATGAGT
ACAACTTGGCAAGCCCAGATGGCCAAGATGCCCTGTGCATGGACCAAGCTTGGGTTGCCCAAGTAGTCAAGTCCACCCTCACTGAAGATTTGAGA
TTCAGCCTTGAAACAGACAGCCTCACCAAACTTGACACCATTACGGGCCAAGAGCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203293] SGN-U579405 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23039 [Download] [View] Facility Assigned ID: TSHAK23TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5