EST details — SGN-E203338

Search information 
Request: 203338Match: SGN-E203338
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C516Clone name: cLEB-3-L7
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C516 [cLEB-3-L7] Trace: SGN-T23085 EST: SGN-E203339 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203338Length: 528 bp (812 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203338 [] (trimmed) ATTCGTTCTCTTTTATCTCTGTCAGCCTCCTTGAGAAGCAAACCATCATGGCAAAACAGAGAAGCAACCAGAGTTCTCGAATTCTGTGGGCCGCA
TTTGCTGCACTGCTCTTGCAGAATTTGGTCATTCCCGTCGTGTCTTTTGCTTCATTTGAAGAAGAGAAAAACTACTACACACCTGATCCACATAC
TGGAAGTCCACCAACAGGTTCAAGCACACCACCCTATCATGCAACTCCATCTCATGGAAGCAGTAGCCATGAAAGCAAACCACCAGCAAACTGTG
GCAACCCTCCAAAAGGAGGGCAGCATCATGACCCTACCCCAGCTTCTCCTTCAGGTGGCTACTATCCCCACCCTCCAAGTACACCTACACCTACA
CCTAGTACCCCATCCACACCCACTATTGTAACCCCACCAACTACTCCTATCATTGACCCTGGCACTCCAAGCACTCCTGCTACCCCAACACCATC
ACCTCCTTTTACATGCGATTACTGGAGGACTTACCCAGGACTGATATGGGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203338] SGN-U567505 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23084 [Download] [View] Facility Assigned ID: TSHAK64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5