EST details — SGN-E203373

Search information 
Request: 203373Match: SGN-E203373
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C340Clone name: cLEB-3-B12
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C340 [cLEB-3-B12] Trace: SGN-T23118 EST: SGN-E203372 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203373Length: 493 bp (622 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203373 [] (trimmed) GGACAGGTCAAATAGCCACCACTAATATCATTTCAGAGTTTAATTTGTAAGCATTCAACACTGGAGTCTGCAGCTGTTAATAAAAAAAGATGTTC
TTGATGGAAATTAGACTAAAACATTCATGCATATCACATATGCAAAAGCTCGTCTTCGATGCACATCTTTGGAGTTGAATTTTAACATCAAAGAG
AATGTAGCTCATTAGGGGAGGGTGGTTGCATTAAGATTGATCCGTCGTCATCTCCAGATGGAAATTGCATGTCCGATTGTAATAGCTGACTACGA
TTTTGATCCTGTGCCGCCGAATATGACTGGGGCTGGGACATCCGGTAATATGGTTCCTTCACATCAAGTTTAACAGATGATGTTTGGAGCATATC
TCCAACAAGAGCTGACAATGTCAGGTAAATGGTATAACTTTGTGCCTTGTGGGCAACTAGGTTAAGCCGGCCAGTTATCTCCTGTCCTGGCATGA
CATAAAGTGGTTGTGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203373] SGN-U589546 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23119 [Download] [View] Facility Assigned ID: TSHAL06TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5