Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E203409

Search information 
Request: 203409Match: SGN-E203409
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470Clone name: cLEB-3-J18
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470 [cLEB-3-J18] Trace: SGN-T23156 EST: SGN-E203410 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203409Length: 583 bp (673 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203409 [] (trimmed) GTCACCGCAAGCACAAACCCTACGCGTCCTCTCACTCAATTAACCGAGCCCCATGGATATTGAAGAGGACATCAAGGCGCTGCAGCTTGATTCAT
CTGAAGATACTGTGTTGGTCAACGTGGAAGATGCTAGACCTGGTGAAGCTATAAAACATGATAAAGTTGATGGAGAGGATAGTTTTATGGAAGAA
GAGAGGAAGACTGATGATGTTGGGAAACCTGATATGCCGGAAGATGGTAGAGTTAAGAGATGAAGCACATCCAGACTTAAAGCCAGAGCATGTCG
ATCCAAAGGGTGTCTCTGGAAAAGAAAGTTCTCCCCCAGAAGATATGCAGGTGGAGGTTGAAGTCAATAAAAAGAGGCATCTGAATGTGGTATTT
ATTGGTCACGTGGATGCTGGAAAGTCTACTATTGGAGGACAAATACTATTACTTAGTGGTCAAGTTGATGACCGTACGATACAAAAGTATGAGAA
AGAAGCCGAAGATAAAAACAGAGAGAGCTGGTATATGGCCTATATTATGGATACAAATGAAGAAGAGAGGGTGAAGGGAATAACAGTTGAAGTAT
GAAGAGCACATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203409] SGN-U563378 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23155 [Download] [View] Facility Assigned ID: TSHAL57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5