Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E203434

Search information 
Request: 203434Match: SGN-E203434
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C569Clone name: cLEB-3-P16
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C569 [cLEB-3-P16] Trace: SGN-T23179 EST: SGN-E203433 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203434Length: 467 bp (606 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203434 [] (trimmed) GAAGCAAAAAAGTGTTGGCAAGTGTGTACATACAAGTTCAAATTTAGTTCATCAAAGAATTTCTCAGTACAAATTCATGTAGAGGTTTATTGGCA
ACCCGGAGAGGAGGGTAAATACGTTCACTCATTATAATTCCGACAAAAGAGCTGTTGTTGCTGCTGCATTTACTTCATATTGGAGTCAAACCAAC
CACACCGCATGCCAATCGTCCACCAGCATTGCCAGTGGTAAGACTGAGTTCATGGCCACCCTTTCCGAGGTCATCCTCAAGCTCATGAACCACAA
GTGCTCGTCCAACAACTGAGTTTGGACCGGTCAATGGTATCTGATTATCTACAAGTGTCACTTCAGCCACGCCATCGGCATTGGCCACTATGTTT
CCCAGGTCACCCGCATGACGGATTTCATCTCCAGGAGCTCCATGTGTCAATTTATTCGGATTAAAATGGGCTCCTGTAGACATACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203434] SGN-U583863 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23180 [Download] [View] Facility Assigned ID: TSHAL92TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5