EST details — SGN-E203581

Search information 
Request: 203581Match: SGN-E203581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2267Clone name: cLEC-15-G1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183900 is on microarray TOM1: SGN-S1-1-7.3.19.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183900 [TUS-43-G2] Trace: SGN-T196871 EST: SGN-E395545 Direction: 3' Facility: INRA
Clone: SGN-C183900 [TUS-43-G2] Trace: SGN-T196872 EST: SGN-E395546 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203581Length: 414 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203581 [] (trimmed) CAGAGATGTTGCATTGGCTTTTTACAAGGAGATGCGTCGGTCTAAGATTTCGCCTAATGTTTATACCTTTAATATGGTCGTGAGTGCTTTATGCA
AATCGGGAAAACTAGAAAAGGCTGTTGAGGTCTTAAGGGAGATGGAGAACATAAGTTTGAAACCGACAGCTGTGTCTTATAACACTTTGATTGCT
GGACATTGTAACCGGGACCTCTTGAGTGTTGCAATGAAACTTAAGACCACGATGGAGATGAATGGGATACAACCAGTTAATGTTACATACAACAC
TCTTATTCATGGTTTATGCAAGGTAGGGAAATTACATGAAGCAAACAAACTTTTCAGCGAGATGAAGAGAACCGGTGTGGCTCCTAATGTTGTCA
CTTATAATACGCTGATAAACGCATATAGTCAGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203581] SGN-U575567 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26682 [Download] [View] Facility Assigned ID: TCACE37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5