Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E203753

Search information 
Request: 203753Match: SGN-E203753
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2840Clone name: cLEC-17-G14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181837 is on microarray TOM1: SGN-S1-1-6.1.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181837 [TUS-38-A3] Trace: SGN-T194640 EST: SGN-E393314 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203753Length: 486 bp (1015 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E203753 [] (trimmed) TTATTTTTTTCTTCTTCAAAATTGAATCTTTTCAGTGAACTTTTACTATTTGGTCAATCAAGAAGTGAAATTACAGAGCAAAAGCAGATATAGTT
TTGAAGATGGCAGGTTACAGAGGTGATGATGAGTATGATTACCTTTTCAAGCTTGTGTTGATAGGTGATTCAGGTGTGGGTAAATCTAATCTGCT
TTCCAGGTTCACCAAAAATGAATTCAATTTGGAGTCTAAATCAACTATTGGGGTTGAATTTGCAACCAAAAGTCTTAATATTGATGGTAAAGTTA
TTAAAGCTCAGATTTGGGATACTGCTGGTCAAGAAAGGTATCGTGCCATTACGAGTGCTTATTATCGGGGAGCTGTCGGTGCTTTGCTCGTATAT
GATGTTACTCGACATGTTACCTTTGAAAACGTCAACAGGTGGTTGAAGGAATTGAGAGACCATACTGACCCTAACATTGTAGTCATGCTCCTAGG
CAACAAATCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203753] SGN-U564990 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27169 [Download] [View] Facility Assigned ID: TCACN43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5