EST details — SGN-E203842

Search information 
Request: 203842Match: SGN-E203842
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2893Clone name: cLEC-17-K17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186532 [TUS-50-D18] Trace: SGN-T352286 EST: SGN-E551411 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203842Length: 528 bp (1028 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E203842 [] (trimmed) CACGCTATTATTTTCTCCAATAACTAACCAAATTCTTCTAGAACAATTATTCCAAATCTATGGCTTCTTCTTCTTTTCTTCTCTCCACTTCAATT
ACCGGCTCTAAACTCTCCGCCGCTGCACCACCGCGGAGTTCTGTTAGCTTCAAGCAGCGGCCGTTCTCTGTTTCCGCCGCGTACTCCACTGCGGA
GAGGACTTCTACTGCTACTACTAGTAGCTCTACAATCGCCTCACATACATCGATATACGAAGTTATAGGGATTCAATTCGGAGCTAATTCTCATG
AAATTAAGTCTGCTTACCGGAAATTAGCCAGAATTTTGCATCCAGATGTTCGTAATTCGTCGGCGGAGGACTTTATAAGAGTCCAATCAGCGTAT
GCTACTCTTTCCGATCCGGAAAAACGTGCTAATTATGATCGGAACCTATTTGGAAATAGAATTGCAAGGCCTGTTGATTTCTCAACGGCGGGAGC
TCGCAGCCATTATACTGTTCGCCGAGGATGGGAAACCGATCAGTGTTGGTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203842] SGN-U565918 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27258 [Download] [View] Facility Assigned ID: TCACM69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5