EST details — SGN-E203885

Search information 
Request: 203885Match: SGN-E203885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2792Clone name: cLEC-17-D23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203885Length: 411 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E203885 [] (trimmed) CTTGTTCTTCATGTTCTTATTCTCCGGCACCATCGTATCAGACAAAAAAAAAATCCCACTTTTTAAAACCCCAAATTCATAAATTTTTCGAAACC
CCAAATCTTTTTTTTCACTCTTTCTATGCTCTAACGAAAAAAAAAGACATCTTTTTTGGCATAATACACCAAAATGGTGGGTCTTGGAAATTCCT
TTGTGATATTTACATTCGTTTAGCGTTCTATATGTGTATTTACATCAGCAGATTCATCTATATATGAAGTGCTTAAATCCCATGGATTGCCAATG
GGATTATTACCAAAGGGTGTGAGGAATTTCACTTTAGATAATTCTGGGAGTTGGGTGGTTCATTTAGATCAACCTTGTAATTCAAAATTTGAGAA
CAAAGAAAATGAATTGCACTATGAAAGGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203885] SGN-U580044 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27301 [Download] [View] Facility Assigned ID: TCACO24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0309 Quality Trim Threshold: 14.5