Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E204285

Search information 
Request: 204285Match: SGN-E204285
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1735Clone name: cLEC-13-L22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173155 is on microarray TOM1: SGN-S1-1-8.3.20.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204285Length: 478 bp (914 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204285 [] (trimmed) AGCAGATGCAATTGTGGTCCGAAGAACACTTTCATGTTTGGCTGAAAATCCTCATGGTTTACCTGGTGTTAATGAAAGCAGTGAACAAGTTGAGA
GGAGGGAGGCATTTTGGTCAAGCATAAAGCCAGCTCACTTTGGTGTGAAGATAGCATCAAAATCTCCATTAGGAGTTGTTCGTTTCATTATAGTC
GGGCTGTTCATTGGTCTCTTTGGTAAAATTGGTTTAGGGAGGTGGCTGCTATTGAAATTCCCTTCATTGTTCAGTCTTGGATGGTTCAGGAAAAA
AGGTCCAACTGAAGATGAAGTGGCAAGTGCTACTTTTAAGATGTGGTTTGTTGGACACGGGTATAGCGATGGCAGTCTTGCATCACAAGGAAACA
GGAAGCCTGATACAGAGATAATTACAAGAGTAATGGGACCTGAGATTGGTTATTTAACAACTCCAATCATTCTTGTCCAGTGTGCTCTCATTTTG
CTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204285] SGN-U573018 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26038 [Download] [View] Facility Assigned ID: TCABZ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5