EST details — SGN-E204418

Search information 
Request: 204418Match: SGN-E204418
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1562Clone name: cLEC-13-D12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173097 is on microarray TOM1: SGN-S1-1-2.4.20.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173097 [TUS-15-D23] Trace: SGN-T188790 EST: SGN-E374560 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204418Length: 433 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204418 [] (trimmed) TTTTCTCTCAAACTTTGTATATCACCAATTTTTTTCTCTTGAAAAACCTCACAAGCTTCTTCTCAATTCAACCTCATCATGTCTCAGACTGTCGT
TCTCAAGGTTGGCATGTCATGCGAAGGCTGTGTTGGTGCTGTGAAAAGGGTTTTGGGGAAAATGGAAGGTGTAGAAACTTTCGACATTGATCTGA
AGGAGCAAAAGGTGACTGTGAAGGGCAATGTTCAACCAGATGCTGTTCTCAAGACTGTGTCAAAGACTGGAAAGCCAACATCTTTCTGGGAAGCA
GGCGAATCGGCTCAAACAGAAGCTGTTAGTACAGCTTGATGGTGTATAATGACTTGGAATTGTATGTTAAGGCTTGAGCAATATATGACTTTATC
AAGAATTCTCCTATGTAATAGTTTGAAATCAGAATTGCAATAAGTTGTTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204418] SGN-U563443 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26171 [Download] [View] Facility Assigned ID: TCABZ18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0226 Quality Trim Threshold: 12.5