EST details — SGN-E204622

Search information 
Request: 204622Match: SGN-E204622
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1836Clone name: cLEC-14-A4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173201 is on microarray TOM1: SGN-S1-1-2.1.20.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173201 [TUS-15-I7] Trace: SGN-T188508 EST: SGN-E374864 Direction: 3' Facility: INRA
Clone: SGN-C173201 [TUS-15-I7] Trace: SGN-T188509 EST: SGN-E374865 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204622Length: 369 bp (862 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204622 [] (trimmed) GCCATATCAAGGGATGAGCACCCACGAGCTCCTCTAGCCCAATGGATAGTTGGTTATGCATCTGGGTGTGTAGCAATTCTCCCTCTTCTCTACTG
GCGTTTTCGTCATAGAAACCAAAATTCAGATCAGGATTCATCTCAGCAGCCACAGATTTCTTCCCAGGTTGAACTCTCAGCCAGACCATCCTCAA
GTACAAGGAGTTCACAAGGTGAAGGTCGTCAGACAACTGCTACAGCTTCTACAGGTGGTCAAAGTAATGAAATACTGAGCACAAGGATAAAATCA
TTTGTTGAGTACTTCAAAATGGCATTAGATTGTTTTTTTGCAGTGTGGTTTGTGGTTGGAAATGTGTGGATATTTGGCGGACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204622] SGN-U568768 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26238 [Download] [View] Facility Assigned ID: TCACB02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5