EST details — SGN-E204644

Search information 
Request: 204644Match: SGN-E204644
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2005Clone name: cLEC-14-I4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181004 is on microarray TOM1: SGN-S1-1-7.2.17.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181004 [TUS-35-N10] Trace: SGN-T193960 EST: SGN-E392634 Direction: 3' Facility: INRA
Clone: SGN-C181004 [TUS-35-N10] Trace: SGN-T199205 EST: SGN-E397879 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204644Length: 454 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204644 [] (trimmed) TGGATCCACAGGTTATAACTGGCTCTCATGACAGTACCATTAAGTTCTGGGACCTTAGATATGGTAAGACAATGGCAACTCTCACACATCACAAG
AAATCTGTTCGAGCTATGGCTCAGCATCCTACAGAGGATTGTTTTGCTTCTGCATCAGCAGACAACATAAAAAAGTTCAGTCTTCCAAAAGGAGA
ATTTATGCACAACATGCTTTCCCAACAGAAAACCATAGTCAACGCGATGGCAATTAATAATGACGGTGTAATGGTCACTGGAGGTGACAATGGAA
GCATGTGGTTTTGGGATTGGAAAAGCGGTCACAATTTCCAGCAATCTCAAACTATTGTTCAACCTGGGTCACTGGACAGTGAGGCTGGCATTTAT
GCCCTCACCTACGATGTAACCGGCTCAAGGCTGATCAGCTGTGAAGCTGATAAGACCATCAAGATGTGGAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204644] SGN-U567467 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26260 [Download] [View] Facility Assigned ID: TCACB50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0100 Quality Trim Threshold: 12.5