EST details — SGN-E204674

Search information 
Request: 204674Match: SGN-E204674
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1903Clone name: cLEC-14-D9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183816 is on microarray TOM1: SGN-S1-1-3.3.19.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183816 [TUS-43-C14] Trace: SGN-T196847 EST: SGN-E395521 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204674Length: 525 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204674 [] (trimmed) ATAGGCTTGATTATTTTTATAATCAAGGAAAAAATGATTTTTTCGAATCAAGAATTGCAAAATACAAATCAACTATATTTAGAACGAATATGCCA
CCGGGACCATTCATCACTTCCAACCCGAAGGTAATTGTTTTGCTCGACGGCAAGAGTTTTCCGGTACTTTTCGATGCATCGAAAGTTGAAAAGAA
GGATCTCTTCACCGGAACTTTCGTGCCGTCGACTGAACTCACCGGTGGTTATCGTATTCTTTCGTATCTCGACCCATCTGAACCAAACCATGAAA
AATTGAAAAAGTTGATGTTCTTCCTTCTTTCTTCACGTCGTGATCATGTTATACCTGAGTTCCATGAAACTTATACAGAGCTTTTCGAAACCCTA
GATAAGGAAATGGAGGAAAAAGGTACAGTTGGTTTTAACTCCGGCAGTGATCAAGCTGCGTTCAATTTCTTAGCTCGGTCGTTATTTGGAGTTAA
CCCAGTGGAAACTAAGCTCGGAACTGATGGTCCGGCATTGATCGGAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204674] SGN-U566154 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26290 [Download] [View] Facility Assigned ID: TCACC17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5