Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E204692

Search information 
Request: 204692Match: SGN-E204692
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2029Clone name: cLEC-14-J5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183858 is on microarray TOM1: SGN-S1-1-1.1.19.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183858 [TUS-43-E8] Trace: SGN-T196860 EST: SGN-E395534 Direction: 3' Facility: INRA
Clone: SGN-C183858 [TUS-43-E8] Trace: SGN-T196861 EST: SGN-E395535 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204692Length: 543 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204692 [] (trimmed) ATTTTGGGTAGCGGAGGATTTGGAGTTGTGTACAAGGGCCGCTTAAATAATGGAACTGTCGTGGCTGTCAAAAGATTAAAGGACTACAATGCTGT
TGGTGGTGAAATCCAATTTCAGACAGAAGTTGAGTTGATTAGTTTGGCGGTTCATCGAAATCTTCTCCGTCTTTGGGGTTTTTGTTCAACTGAAA
GTGAAAGGCTTCTTGTTTACCCCTATATGCCAAATGGAAGTGTAGCAGCACGATTAAAAGATCATATCCATGGCAGGCCAGTTTTGGACTGGTCA
AGGCGGAAAGGAATAGCAGTAGGTACAGCAAGAGGGCTAGTATATTTGCATGAACAATGTGACCCCAAAATTATCCATCGTGATGTGAAAGCAGC
CAACATTCTGTTGGATGAGGAATTTGAAGCAGTTGTTGGAGATTTTGGGTTAGCAAAGCTCTTAGATCACCGGGATTCTCATGTAACGACTGCTG
TGAGGGGCACAGTTGGTCACATTGCTCCAAAATATCTTTCAACGGGTCAATCGTCTGAAAAGACTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204692] SGN-U586426 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26308 [Download] [View] Facility Assigned ID: TCACC51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5