Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E204713

Search information 
Request: 204713Match: SGN-E204713
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2154Clone name: cLEC-14-P7
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173372 is on microarray TOM1: SGN-S1-1-7.4.20.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173372 [TUS-15-P10] Trace: SGN-T189037 EST: SGN-E375423 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204713Length: 602 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204713 [] (trimmed) TTCAGCTCGAATTCGTTGACTGGTTCCATACCAAGTTCATTATCAAGTTTGAGAAGTCTCACAAACTTGAATTTGCAGGGGAATAAACTAAGCGG
TCGAATTCCGGTTGACATTAGTAACTTAAATGTGCTGTTAGAACTCCAACTTGGAGGGAACCAACTCAGTGGGCCTATTCCTGATATGCCATTGA
GTTTACAGATTGCTTTGAATCTGAGTCACAATCTTTTTCAAGGACCTATACCAAGTAGTTTTTCTAGATTGACTTCATTGGAAGTTTTGGATCTC
TCTTACAACAGGTTCTCGGGTCAGATTCCAGAGTACCTGGCCGGAATGAAAGGCTTGACTAGGTTGGTGCTTTCAAACAATCAACTGTCTGGAGT
TGTTCCAAAGTTTGGAAGTTTTGTCATTGTTGATACAGATGGAAATGGGGTTCTGATCTATCCTTCACCAGTTGCTCCACCACAAGCTGCTGCAA
AAAAGAGAAAATCAATAGTTGTTGCAGTTGTTGTCCCAATTGCAGGTGTAGCAACAATTGCCATTTTCGTGGTGATTGCTATTTCAATCTCTAGA
AGAAATTACAGGATCCATGATGAACATTTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204713] SGN-U573289 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26329 [Download] [View] Facility Assigned ID: TCACC88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5