EST details — SGN-E204884

Search information 
Request: 204884Match: SGN-E204884
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1936Clone name: cLEC-14-F2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173257 is on microarray TOM1: SGN-S1-1-2.3.20.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173257 [TUS-15-K15] Trace: SGN-T188598 EST: SGN-E374954 Direction: 3' Facility: INRA
Clone: SGN-C173257 [TUS-15-K15] Trace: SGN-T188599 EST: SGN-E374955 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204884Length: 329 bp (882 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204884 [] (trimmed) GTTTTCTTTTCCAAGATCCCACCCTCCTTGAATAATTTTCGAGCAGTTTTTAAAGAAAATGACATTGTAATGGTTGAGCCAACAACTTCCAACTT
TGTGGGAAATATCCATAGCTCAAAAGAGAAGATAGATATTGAGATGGGAACAATGTTTCCAGAGGATAGTGGCCTATCACTTCCTGAAATTTTGC
GGAATTTGGAATATGAGGAGATAGATGATACTTTAAAAAGCAGGGAATGGACCAGAGATGCTTATTCTGATTCTGGTGAGCAAATGCGGAGCATC
ACCAGCTTAAAGGAGACAATTGATACTGAGGTGGGAGATAACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204884] SGN-U562633 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26500 [Download] [View] Facility Assigned ID: TCACD25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0179 Quality Trim Threshold: 14.5