Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E205120

Search information 
Request: 205120Match: SGN-E205120
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2465Clone name: cLEC-16-C12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173396 is on microarray TOM1: SGN-S1-1-7.1.18.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173396 [TUS-16-A10] Trace: SGN-T192908 EST: SGN-E391582 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205120Length: 567 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205120 [] (trimmed) GGATGGCAAAGGAGAGACACTTGGAGATATCAGCAGTGGCTCCTCCAACACTAAAGAAGAGTATATCAACTCCTTTCATGAACACAGCTTCGAAG
ATGTATTCCATGTCCGAGGTGAGGAAACACAACTCTTCAGACTCTGCTTGGATCATAGTCCATGGACATATCTACGATGCCTCACGTTTCTTGAA
AGACCATCCCGGTGGTGTTGACAGCATTCTGATCAATGCTGGAACTGATTGTACTGAGGAATTTGATGCAATTCATTCTGATAAGGCTAAGAAGC
TATTGGAGGACTTTAGGATTGGTGAACTCATAACTACTGGTTACACGTCTGATTCGTCTCCAAACAGTTCTGTCCATGGATCCTCTTCGATCAGT
AGCTTCTTAGCACCTATTAAGGAGCTTGTTCAAACACCAACAAGGAGTGTAGCTCTCATCCCAAGGGAAAAAATCCCTTGCAAACTCGTCGACAA
GCAATCCATCTCCCATGATGTTAGGAAATTCAAATTTGCATTACCCTCTGAGGATCAAGTCTTAGGGTTACCTGTTGGCATACACATATTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205120] SGN-U579543 Tomato 200607 Build 2 103 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27009 [Download] [View] Facility Assigned ID: TCACJ18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5