EST details — SGN-E205259

Search information 
Request: 205259Match: SGN-E205259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4426Clone name: cLEC-25-H9
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183847 is on microarray TOM1: SGN-S1-1-4.4.18.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183847 [TUS-43-D21] Trace: SGN-T198005 EST: SGN-E396679 Direction: 3' Facility: INRA
Clone: SGN-C183847 [TUS-43-D21] Trace: SGN-T199931 EST: SGN-E398605 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205259Length: 672 bp (935 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205259 [] (trimmed) ATTTACTGGGAAATCCATCTCTATGTGGAAAAAAGTTTCTCAGTCCATGCCACATAAAAAGAAACCGAACGAGTTCTCATGGTTTTTCCAAGAAA
ACCTGGATCATACTTGCAGCACTTGGATCTGTTTTCAGTCTCATTCTTCTTGTCCTGGGAATATTTTTATTTCATCGGTACATGAAGAAGAAGAA
AAAAGTGAATGACACGGAGTTTACAAATCCAAAGTGTACCGCAGCACTGAGCCTCCAGAGATTTTATCAAAAGGATTTGGAACATGCTACCAATA
ATTTCCGTCCGGAAAACATTATTGGAGCCAGCAGTTTAAGTACTGTGTACAAAGGAACACTGGAAGATGGGAAGATTGTAGCAGTTAAGAAGCTG
AATCACCAGTTCTCAGCAGAATCTGGTAAATGTTTTGATAGGGAAGTCAAGACTCTGAGCCAACTCAGACACAGGAACCTAGTTAAGGTGCTAGG
TTACGCTTGGGAAAGCAAGAAGCTAAGGGCTTTAGTTTTAGAATACATGGAGAATGGGAACTTGGACAACATGATTTATTGTCAAGTAGAGGATG
ACTGGACGTTGTCCAACAGGATTGATATTTTAGTTTCAGTTGCAAGTGGACTATCATACCTGCATTCAGGCTATGATTTTCCAATAGTGCACTGT
GACATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205259] SGN-U586739 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28675 [Download] [View] Facility Assigned ID: TCADU41TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5