EST details — SGN-E205538

Search information 
Request: 205538Match: SGN-E205538
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4706Clone name: cLEC-28-N16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183893 is on microarray TOM1: SGN-S1-1-6.2.18.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183893 [TUS-43-F19] Trace: SGN-T198019 EST: SGN-E396693 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205538Length: 456 bp (924 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205538 [] (trimmed) AACAAATTCAAGACACGTCCTCATGAAACTATGATAAAAATATAGAGCTAAAAGCCTTTGATGACACGAAAGCCGGTGTTAAAGGCCTTGTTGAT
GCTGGAATTACTCAAGTACCTCGGATATTCATCCATCCAGAGGTTTCAGGCTCGGGGCCTTCCCCGAGCCTGGAGGAAACACGTTTTGTTTTTCC
AATAATAGATCTCGAAAACATCAATAAAGATCCTATCAAGCACAAAGAGATTGTTAAAAAAGTTGGTGATGCTTCAGAGACATGGGGATTCTTGC
AAGTGATCAATCATGGTATTCCGATGTCAGTCCTGGATGAAATGCTACGAGGAGCACGAGGTTTCTTCGAGCAAGATATTGACGTTAAGAAGAAA
TATTATCATCGCGATTATACACGGAGAGTGGTGTATAATAGCAATTGTGATTTGTATAACCCTAAGGCTTTAGCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205538] SGN-U578797 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29025 [Download] [View] Facility Assigned ID: TCAEH80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5