Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E205638

Search information 
Request: 205638Match: SGN-E205638
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3584Clone name: cLEC-21-B16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205638Length: 523 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205638 [] (trimmed) GTAAAGCAAAAACACAGCTTAAGTTGAAAGATGGCTGATGTTAAGTTGATTGGTTTATGGTATAGTCCTTTTAGTAGAAGAGTTGAATGGGCTCT
AAAGATTAAGGGTGTGGAATATGAATATATAGAAGATGATCTACATAATAAAAGCCTTTTACTTCTTCAATCTAATCCAATTCACAAGGCAGTTC
CTGTGCTCATTCACAATGGCAAGCCCCTTTGTGAATCAAGTGTCATTCTCGAATACATCGACGAGACATTTGAAGGCCCTTCCATCTTGCCTAAA
GAACCTTACGATCGATCTTTAGCTCGTTTCTGGGCTAAATTCTTCGATGATAAGGGGCTAGCAATAAGGAAAAGTATATTTTTCAAAGGAGAGGA
GCAAGAGAAAGCTAAAGAGGAAGTTTATGATATGTTGAAAGTTCTTGATAATGAGCTGAAAAACAAGAAGATTTTTGTTGGTGAAAAATTTGGAT
TTGTTGATATTGTTGCAAATGCTGCAGCCCTTTGGCTAGGAGTTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205638] SGN-U577816 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27961 [Download] [View] Facility Assigned ID: TCADF08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5