EST details — SGN-E205954

Search information 
Request: 205954Match: SGN-E205954
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3533Clone name: cLEC-20-O17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173593 is on microarray TOM1: SGN-S1-1-2.1.18.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173593 [TUS-16-I15] Trace: SGN-T192872 EST: SGN-E391546 Direction: 3' Facility: INRA
Clone: SGN-C173593 [TUS-16-I15] Trace: SGN-T192873 EST: SGN-E391547 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205954Length: 539 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205954 [] (trimmed) CCTTTTTATCCTTTTTTTTTCTTCATTCTTGAATTCATGAGAAAAAGAAGAATGACAACCATAAAATATGATCCAAATTTCAACCTACAAAAAAT
GAAAGAATATCCACAACATAAAGTTTTATTAGAAGAAATTGAAGGTCTTATTAAAGTATACAAAAATGGTCATGTTGAAAGGCCTCAAATAGTAC
CAAATGTCACTAATAAACTACCTCTTGAACTTGGTGTTACCTCTAGTGATGTTGTAATCGATAGGTACACAAATATTTGGGCACGTTTATATGTT
CCAAAAACATTATGTCAAGGAAATAAATTGCCTTTGTTAATTTATTTCCATGGTGGTGGATTTTGTGTTGGTTCATCATCTTGGATTTGTTACCA
TGAGTTCTTAGCTAAATTAGCATCAATTGCTAATTGTGTGATTATGTCTGTTAATTATCGATTAGCCCCCGAAAATCGTCTTCCATCGGCTTACG
ACGATGGGGTTAAGACGATTTCTTGGATAAAACAAAAAGTGTTAATTGGTGCTAACGAAGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205954] SGN-U572192 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27736 [Download] [View] Facility Assigned ID: TCACY93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5