EST details — SGN-E205990

Search information 
Request: 205990Match: SGN-E205990
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3501Clone name: cLEC-20-M4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173581 is on microarray TOM1: SGN-S1-1-6.1.18.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173581 [TUS-16-I3] Trace: SGN-T192867 EST: SGN-E391541 Direction: 3' Facility: INRA
Clone: SGN-C173581 [TUS-16-I3] Trace: SGN-T197810 EST: SGN-E396484 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205990Length: 483 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205990 [] (trimmed) GCTTCATGGAACACAAGTATTTTACTATTTTCCTCCAGCTTCTGAAGAGTATGAGTCCCTGACATCTGATGATAGTGCTGCTATTGCATTTACCT
CTGAGCTCCTGGATGATTTAAACGTAGATAGATCAACACCCGACACTTACCGCTCTCCCCCTGCACCAATTCCATTTGAAGTAGATTTGGGGCAT
CCACAGTCAAGAGGAGGTTGCCAGTTCATAGATGAAACATTACTTCAACGTAGCTATGAGATAACTAATTGTAAAGATATTAAGTTTTCTGATCG
CAAAGCTGAAACAGAGTCTCTTCTTGCCTCCCTAAAGAAAGCAGGGATTGACCTTGTAAAATCTAATCCATCTATTATTAAATCAGCAGAAGAAG
AGGATGTTTGTCCTACTTGTCTTGAAGAATATGATGTCGACAATCCAAGAATAGTCTCAAAATGTAACCACCATTTTCATCTTTCATGCATTCTT
GAGTGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205990] SGN-U577032 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27772 [Download] [View] Facility Assigned ID: TCACZ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0164 Quality Trim Threshold: 14.5