EST details — SGN-E206051

Search information 
Request: 206051Match: SGN-E206051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3314Clone name: cLEC-20-D10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173523 is on microarray TOM1: SGN-S1-1-8.2.18.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173523 [TUS-16-F17] Trace: SGN-T196684 EST: SGN-E395358 Direction: 5' Facility: INRA
Clone: SGN-C173523 [TUS-16-F17] Trace: SGN-T196792 EST: SGN-E395466 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206051Length: 521 bp (864 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206051 [] (trimmed) CTAAAACTACTGCATCGCCAATACAATGGGCACAAGGCAAGATAGTTGATGAGCAAAGCTTCTTTAAGTGGTTCAGCGAAGTTGATAATATTGAT
GAAATCGGTGAGATAATCAAGGATGATCTGTGGTCCGATCCTCTCTTTAGTTTTCGATATGAGGCAGATGAAGAAAATGTTGATAATGTGGCAGT
GAAGAAATATGAAGATATGGTAGTGAAGGACAGTGAAGATGTAGAAGAAAATGATTAGAGGTTTGGTCCTTGTTATTCAAATGCCTTAGAAATGG
TTTTGAACTATTCACAAACTTGATTATAGCGACACTCTTCATGTGAGTTTACCTTACTATGTTGATAATTTTGTATTAATCTGTCTGAAGGTATA
TTTTGTCCATAGAAAGATCAGTACAACAGTTCATTCGGATGTGTGATCTCATTTCCTTAGCAGACTAACATATAGAACTGCTGAATTAGTTTGTG
GTGAGCTCGCTGATTAATCTGACAATGGACTACATTGTAGCACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206051] SGN-U565244 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27833 [Download] [View] Facility Assigned ID: TCADB17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0022 Quality Trim Threshold: 12.5