EST details — SGN-E206279

Search information 
Request: 206279Match: SGN-E206279
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4004Clone name: cLEC-23-E13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173622 is on microarray TOM1: SGN-S1-1-5.2.18.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173622 [TUS-16-J20] Trace: SGN-T1286 EST: SGN-E378498 Direction: 5' Facility: Giov. Lab
Clone: SGN-C173622 [TUS-16-J20] Trace: SGN-T196946 EST: SGN-E395620 Direction: 3' Facility: INRA
Clone: SGN-C173622 [TUS-16-J20] Trace: SGN-T196947 EST: SGN-E395621 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206279Length: 579 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206279 [] (trimmed) TTTCATTTACGGTTACAACTTTGGACTTCTTCTTGCAAAAGGACTTCCGAAAAATGGAAAGGATAATGTGAGCTCCGGTTAATCGCAGTATATTT
CTTCAACAAGATCCGGTCTTCTTCTTCTTCATAGTGAGGCAGTCTTCTTCTTCTGTTTGACAAGTATTTTTCTTCATCTCCATTGGTCTTAGTCT
CCAACAGTAATCTTCTTCTACCGCAATTTTTTATAAAGTTTTTTCTCAGATTGGAGACTCTTTTTCCTTCCAAAGCTCATCAAAACTAGCTCGTG
GTCGTTGAAGCTTGTGGCCAGCTCGTGCTCGTCCCAGTATGGCTGCTCCAAAGAAGGTTTGGGGCTTATTCTAAGTAGAATTTAAAGTTTATTCT
CTTGTCAATTAAATTTGTTGGCCTGGCTACATGTTTCCAGCAGGATTTGAATAGTCATGAGTCAACAAGAGCCTTCGAAAAGATACAAAAGAGCA
AAAAAGAACCTTGCTTTACGTGGATCATTATCAATTCTGGGCAAATAAAAAACAACGATTATTGACAACAAATGAAATATTTCAAGCTATAGAGT
GAGGAAACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206279] SGN-U564002 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28238 [Download] [View] Facility Assigned ID: TCADK31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5