SGN ID: SGN-C4041 | Clone name: cLEC-23-F9 |  | Order Clone |
|
Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E206353 | Length: 372 bp (840 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E206353 [] (trimmed)
ATAGGCTTGATTATTTTTATAATCAAGGAAAAAATGATTTTTTCGAATCAAGAATTGCAAAATACAAATCAACTATATTTAGAACGAATATGCCA
CCGGGACCATTCATCACTTCCAACCCGAAGGTAATTGTTTTGCTCGACGGCAAGAGTTTTCCGGTACTTTTCGATGCATCGAAAGTTGAAAAGAA
GGATCTCTTCACCGGAACTTTCGTGCCGTCGACTGAACTCACCGGGGGTTATCGTATTCTTTCGTATCTCGACCCATCTGAACCAAACCATGAAA
AATTGAAAAAGTTGATGTTCTTCCTTCTTTCTTCACGTCGTGATCATGTTATACCTGAGTTCCATGAAACTTATACAGAGCTTTTCG
[BLAST] [AA Translate]
SGN-ID: SGN-T28312 [Download] [View] |
Facility Assigned ID: TCADM29TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 |
Expected Error Rate: 0.0095 |
Quality Trim Threshold: 14.5 |