EST details — SGN-E206375

Search information 
Request: 206375Match: SGN-E206375
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4187Clone name: cLEC-23-N21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173675 is on microarray TOM1: SGN-S1-1-8.1.18.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173675 [TUS-16-M1] Trace: SGN-T192893 EST: SGN-E391567 Direction: 3' Facility: INRA
Clone: SGN-C173675 [TUS-16-M1] Trace: SGN-T192894 EST: SGN-E391568 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206375Length: 570 bp (837 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206375 [] (trimmed) TGATGATTCATTCTTTGTACAAAAAGATCGGGAAAAAAAAAGTTCAGTTTTTTATCTTTGGTATTTCACTTTTTGGGTCGTTTTCAAATTTTTAA
GAAAATGCAAGTAATACCCAAATGGCGTAATGTTTTGATCTTGAAGAATTCACTTATTCAATCCACAAGAATAGTATCTTCTACACAATCACAAA
ATACCCATTTGAGCTCTTTCCATTCGACCTCAATATGCTTTGAGAAATGGAAAAATAAGTGGAATTCTGATTTTAGAGGAAGTCAGCAGCCAACT
AAGAATTATATCAGATATGAAACACGTCAAAAGCGTGCTGACTCAAAAAAAGCTTTGAAAAATCTTCTCTTTTATGGGGCATCTGGAAACTCTTT
TGAGAATGAATCTTCAACAATAAATGATAGATGGGATATGGATCGGGATGATCGTTCAGAGAAGAAAAGTGAATATAAGTCCGCTGCTCGTCTTA
GAGATCGCTCAAGGAGAAGGATGCGAAAAATGAAGAAACGGAGATTATATGAAGAATTCGATGAATATCCTGAATCAGTATTCGAAGCAACTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206375] SGN-U583864 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28334 [Download] [View] Facility Assigned ID: TCADM83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5