| SGN ID: SGN-C5436 | Clone name: cLEC-31-N7 |  | Order Clone |
|
| Library Name: cLEC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E206639 | Length: 220 bp (778 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E206639 [] (trimmed)
GCTTTGTTACAGGGGTTCGGGAGTTGATTCAGGTTGGTTGGGTTTAGATGGTGCTGGTCCATCTACAGGCATCAGGTCAGCAGCGAGTTTGGGTC
GGGTTCAGACAGTGATGAGGCATCTTGCAGCTGTTGGAGAAACGTATGCACAAACTGCTCTGGAAGATGCTGGCTGGAATCTTTGGTCTATGCGT
GCCTCCCAAGCTGGTACTTCCAGTTCAGCA
[BLAST] [AA Translate]
| SGN-ID: SGN-T29605 [Download] [View] |
Facility Assigned ID: TCAES76THB
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.938 |
Expected Error Rate: 0.0200 |
Quality Trim Threshold: 14.5 |
