Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E206876

Search information 
Request: 206876Match: SGN-E206876
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5825Clone name: cLEC-33-D4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C168591 [TUS-3-I5] Trace: SGN-T565 EST: SGN-E379033 Direction: 5' Facility: Avesthagen
Clone: SGN-C168591 [TUS-3-I5] Trace: SGN-T951 EST: SGN-E379892 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206876Length: 620 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206876 [] (trimmed) CAGGTGGTTTCTGCCCATTTAGATAGTGGAAGATCAGTAGATGAGCAAGGCGTAGAAGAAGCTTTTGAACTTCTTTATGAGATAAATGAACGGGT
CAGGACCGGAATTTGGGTTGGTGATTGCTTCATTTACAATAATTCTTCCTGGAGACTTAACTACTGTGTTGGTGGTGAGGTGACCACAATGTTTC
ATTTAGACCGGCCTATGTACCTGCTCGGATATCTAGCAAACCAGAGTAGGGTTTTTCTGATTGACAAAGAGTTCAATGTCATTGGATATACTTTG
CTGCTCAGCCTGGTTGAGTACAAGACGCTTGTGATGCGTGGTGACTGGGACAGAGCAAATGAGGTGCTGCCATCTATTCCTAAGGAGCACCATAA
TAGTGTTGCTCATTTCTTGGAGTCGCGAGGTATGGTAGAGGAAGCATTAGAAGTTGCAACAGAGCCTGACTACAGATTTGATCTAGCCATACAGC
TGGGAAAATTAGAAATTGCAAAGGATATTGCAGTGGTCGCTCAAAGTGAGTCCAAATGGAAGCAGTTGGGTGAACTAGCCATGTCTGATGGAATG
CTGGAGATGGCAGAGGAATGTCTGAAGTATGCCAATGACTTGAGGGGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206876] SGN-U585844 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30148 [Download] [View] Facility Assigned ID: TCAFB14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5